Evaluation of an Image-Derived Input Function for Kinetic Modeling of Nicotinic Acetylcholine Receptor-Binding PET Ligands in Mice.

Positron emission tomography (PET) radioligands that bind with high-affinity to α4ß2-type nicotinic receptors (α4ß2Rs) allow for in vivo investigations of the mechanisms underlying nicotine addiction and smoking cessation. Here, we investigate the use of an image-derived arterial input function and the cerebellum for kinetic analysis of radioligand binding in mice. Two radioligands were explored: 2-[18F]FA85380 (2-FA), displaying similar pKa and binding affinity to the smoking cessation drug varenicline (Chantix), and [18F]Nifene, displaying similar pKa and binding affinity to nicotine. Time-activity curves of the left ventricle of the heart displayed similar distribution across wild type mice, mice lacking the ß2-subunit for ligand binding, and acute nicotine-treated mice, whereas reference tissue binding displayed high variation between groups. Binding potential estimated from a two-tissue compartment model fit of the data with the image-derived input function were higher than estimates from reference tissue-based estimations. Rate constants of radioligand dissociation were very slow for 2-FA and very fast for Nifene. We conclude that using an image-derived input function for kinetic modeling of nicotinic PET ligands provides suitable results compared to reference tissue-based methods and that the chemical properties of 2-FA and Nifene are suitable to study receptor response to nicotine addiction and smoking cessation therapies.

Accelerator-Based Production of Scandium Radioisotopes for Applications in Prostate Cancer: Toward Building a Pipeline for Rapid Development of Novel Theranostics.

In the field of nuclear medicine, the ß+ -emitting 43Sc and ß- -emitting 47Sc are promising candidates in cancer diagnosis and targeted radionuclide therapy (TRT) due to their favorable decay schema and shared pharmacokinetics as a true theranostic pair. Additionally, scandium is a group-3 transition metal (like 177Lu) and exhibits affinity for DOTA-based chelators, which have been studied in depth, making the barrier to implementation lower for 43/47Sc than for other proposed true theranostics. Before 43/47Sc can see widespread pre-clinical evaluation, however, an accessible production methodology must be established and each isotope's radiolabeling and animal imaging capabilities studied with a widely utilized tracer. As such, a simple means of converting an 18 MeV biomedical cyclotron to support solid targets and produce 43Sc via the 42Ca(d,n)43Sc reaction has been devised, exhibiting reasonable yields. The NatTi(γ,p)47Sc reaction is also investigated along with the successful implementation of chemical separation and purification methods for 43/47Sc. The conjugation of 43/47Sc with PSMA-617 at specific activities of up to 8.94 MBq/nmol and the subsequent imaging of LNCaP-ENZaR tumor xenografts in mouse models with both 43/47Sc-PSMA-617 are also presented.

X-ray Activated Nanoplatforms for Deep Tissue Photodynamic Therapy.

Photodynamic therapy (PDT), the use of light to excite photosensitive molecules whose electronic relaxation drives the production of highly cytotoxic reactive oxygen species (ROS), has proven an effective means of oncotherapy. However, its application has been severely constrained to superficial tissues and those readily accessed either endoscopically or laparoscopically, due to the intrinsic scattering and absorption of photons by intervening tissues. Recent advances in the design of nanoparticle-based X-ray scintillators and photosensitizers have enabled hybridization of these moieties into single nanocomposite particles. These nanoplatforms, when irradiated with diagnostic doses and energies of X-rays, produce large quantities of ROS and permit, for the first time, non-invasive deep tissue PDT of tumors with few of the therapeutic limitations or side effects of conventional PDT. In this review we examine the underlying principles and evolution of PDT: from its initial and still dominant use of light-activated, small molecule photosensitizers that passively accumulate in tumors, to its latest development of X-ray-activated, scintillator-photosensitizer hybrid nanoplatforms that actively target cancer biomarkers. Challenges and potential remedies for the clinical translation of these hybrid nanoplatforms and X-ray PDT are also presented.

Trapping of Nicotinic Acetylcholine Receptor Ligands Assayed by In Vitro Cellular Studies and In Vivo PET Imaging.

A question relevant to nicotine addiction is how nicotine and other nicotinic receptor membrane-permeant ligands, such as the anti-smoking drug varenicline (Chantix), distribute in brain. Ligands, like varenicline, with high pKa and high affinity for α4ß2-type nicotinic receptors (α4ß2Rs) are trapped in intracellular acidic vesicles containing α4ß2Rs in vitro Nicotine, with lower pKa and α4ß2R affinity, is not trapped. Here, we extend our results by imaging nicotinic PET ligands in vivo in male and female mouse brain and identifying the trapping brain organelle in vitro as Golgi satellites (GSats). Two PET 18F-labeled imaging ligands were chosen: [18F]2-FA85380 (2-FA) with varenicline-like pKa and affinity and [18F]Nifene with nicotine-like pKa and affinity. [18F]2-FA PET-imaging kinetics were very slow consistent with 2-FA trapping in α4ß2R-containing GSats. In contrast, [18F]Nifene kinetics were rapid, consistent with its binding to α4ß2Rs but no trapping. Specific [18F]2-FA and [18F]Nifene signals were eliminated in ß2 subunit knock-out (KO) mice or by acute nicotine (AN) injections demonstrating binding to sites on ß2-containing receptors. Chloroquine (CQ), which dissipates GSat pH gradients, reduced [18F]2-FA distributions while having little effect on [18F]Nifene distributions in vivo consistent with only [18F]2-FA trapping in GSats. These results are further supported by in vitro findings where dissipation of GSat pH gradients blocks 2-FA trapping in GSats without affecting Nifene. By combining in vitro and in vivo imaging, we mapped both the brain-wide and subcellular distributions of weak-base nicotinic receptor ligands. We conclude that ligands, such as varenicline, are trapped in neurons in α4ß2R-containing GSats, which results in very slow release long after nicotine is gone after smoking.SIGNIFICANCE STATEMENT Mechanisms of nicotine addiction remain poorly understood. An earlier study using in vitro methods found that the anti-smoking nicotinic ligand, varenicline (Chantix) was trapped in α4ß2R-containing acidic vesicles. Using a fluorescent-labeled high-affinity nicotinic ligand, this study provided evidence that these intracellular acidic vesicles were α4ß2R-containing Golgi satellites (GSats). In vivo PET imaging with F-18-labeled nicotinic ligands provided additional evidence that differences in PET ligand trapping in acidic vesicles were the cause of differences in PET ligand kinetics and subcellular distributions. These findings combining in vitro and in vivo imaging revealed new mechanistic insights into the kinetics of weak base PET imaging ligands and the subcellular mechanisms underlying nicotine addiction.

Preliminary investigation of 48V-labeled VO(acac)2 for cancer imaging: An initial proof-of-concept study.

In this preliminary study, a procedure for synthesizing novel PET radiotracer vanadium-48-labeled-vanadyl acetylacetonate was developed, including radioisotope production via cyclotron, separation of 48V, chelation as 48VO(acac)2, and assessment through in vitro cellular studies. We employed the beam-stop setup in a cyclotron as the target holder to irradiate titanium foils in the reaction of natTi (p,n)48V. The radioisotope production rate was 4.84 ± 0.67 µCi/µA-h. Overall radiochemical yield was 12.86 ± 0.51% with gamma-ray spectroscopy showing no detectable contaminant peaks. HPLC of 48VO(acac)2 showed a retention time (1:48) corresponding closely to that (1:50) of commercial VO(acac)2, verifying the successful synthesis of 48VO(acac)2. In vitro cellular studies demonstrated radiotracer uptake and saturation around 0.48 nM. These studies pave the way for improving methodologies and in vivo experiments, including imaging studies, in future investigations.

In†Vivo Imaging of the Tumor-Associated Enzyme NCEH1 with a Covalent PET Probe.

Herein, we report the development of an 18 F-labeled, activity-based small-molecule probe targeting the cancer-associated serine hydrolase NCEH1. We undertook a focused medicinal chemistry campaign to simultaneously preserve potent and specific NCEH1 labeling in live cells and animals, while permitting facile 18 F radionuclide incorporation required for PET imaging. The resulting molecule, [18 F]JW199, labels active NCEH1 in live cells at nanomolar concentrations and greater than 1000-fold selectivity relative to other serine hydrolases. [18 F]JW199 displays rapid, NCEH1-dependent accumulation in mouse tissues. Finally, we demonstrate that [18 F]JW199 labels aggressive cancer tumor cells in vivo, which uncovered localized NCEH1 activity at the leading edge of triple-negative breast cancer tumors, suggesting roles for NCEH1 in tumor aggressiveness and metastasis.

A novel mouse model of sporadic colon cancer induced by combination of conditional Apc genes and chemical carcinogen in the absence of Cre recombinase.

Although valuable insights into colon cancer biology have been garnered from human colon cancer cell lines and primary colonic tissues, and animal studies using human colon cancer xenografts, immunocompetent mouse models of spontaneous or chemically induced colon cancer better phenocopy human disease. As most sporadic human colon tumors present adenomatous polyposis coli (APC) gene mutations, considerable effort has gone into developing mice that express mutant Apc alleles that mimic human colon cancer pathogenesis. A serious limitation of many of these Apc-mutant murine models, however, is that these mice develop numerous tumors in the small intestine but few, if any, in the colon. In this work, we examined three spontaneous mouse models of colon tumorigenesis based upon the widely used multiple intestinal neoplasia (Min) mouse: mice with either constitutive or conditional Apc mutations alone or in combination with caudal-related homeobox transcription factor CDX2P-Cre transgene - either with or without exposure to the potent colon carcinogen azoxymethane. Using the CDX2 promoter to drive Cre recombinase transgene expression effectively inactivated Apc in colonocytes, creating a model with earlier tumor onset and increased tumor incidence/burden, but without the Min mouse model's small intestine tumorigenesis and susceptibility to intestinal perforation/ulceration/hemorrhage. Most significantly, azoxymethane-treated mice with conditional Apc expression, but absent the Cre recombinase gene, demonstrated nearly 50% tumor incidence with two or more large colon tumors per mouse of human-like histology, but no small intestine tumors - unlike the azoxymethane-resistant C57BL/6J-background Min mouse model. As such this model provides a robust platform for chemoprevention studies.

Lung cancer-a fractal viewpoint.

Fractals are mathematical constructs that show self-similarity over a range of scales and non-integer (fractal) dimensions. Owing to these properties, fractal geometry can be used to efficiently estimate the geometrical complexity, and the irregularity of shapes and patterns observed in lung tumour growth (over space or time), whereas the use of traditional Euclidean geometry in such calculations is more challenging. The application of fractal analysis in biomedical imaging and time series has shown considerable promise for measuring processes as varied as heart and respiratory rates, neuronal cell characterization, and vascular development. Despite the advantages of fractal mathematics and numerous studies demonstrating its applicability to lung cancer research, many researchers and clinicians remain unaware of its potential. Therefore, this Review aims to introduce the fundamental basis of fractals and to illustrate how analysis of fractal dimension (FD) and associated measurements, such as lacunarity (texture) can be performed. We describe the fractal nature of the lung and explain why this organ is particularly suited to fractal analysis. Studies that have used fractal analyses to quantify changes in nuclear and chromatin FD in primary and metastatic tumour cells, and clinical imaging studies that correlated changes in the FD of tumours on CT and/or PET images with tumour growth and treatment responses are reviewed. Moreover, the potential use of these techniques in the diagnosis and therapeutic management of lung cancer are discussed.

SIRT3 deacetylates and activates OPA1 to regulate mitochondrial dynamics during stress.

Mitochondrial morphology is regulated by the balance between two counteracting mitochondrial processes of fusion and fission. There is significant evidence suggesting a stringent association between morphology and bioenergetics of mitochondria. Morphological alterations in mitochondria are linked to several pathological disorders, including cardiovascular diseases. The consequences of stress-induced acetylation of mitochondrial proteins on the organelle morphology remain largely unexplored. Here we report that OPA1, a mitochondrial fusion protein, was hyperacetylated in hearts under pathological stress and this posttranslational modification reduced the GTPase activity of the protein. The mitochondrial deacetylase SIRT3 was capable of deacetylating OPA1 and elevating its GTPase activity. Mass spectrometry and mutagenesis analyses indicated that in SIRT3-deficient cells OPA1 was acetylated at lysine 926 and 931 residues. Overexpression of a deacetylation-mimetic version of OPA1 recovered the mitochondrial functions of OPA1-null cells, thus demonstrating the functional significance of K926/931 acetylation in regulating OPA1 activity. Moreover, SIRT3-dependent activation of OPA1 contributed to the preservation of mitochondrial networking and protection of cardiomyocytes from doxorubicin-mediated cell death. In summary, these data indicated that SIRT3 promotes mitochondrial function not only by regulating activity of metabolic enzymes, as previously reported, but also by regulating mitochondrial dynamics by targeting OPA1.

PGC1α-mediated mitofusin-2 deficiency in female rats and humans with pulmonary arterial hypertension.

RATIONALE: Pulmonary arterial hypertension (PAH) is a lethal, female-predominant, vascular disease. Pathologic changes in PA smooth muscle cells (PASMC) include excessive proliferation, apoptosis-resistance, and mitochondrial fragmentation. Activation of dynamin-related protein increases mitotic fission and promotes this proliferation-apoptosis imbalance. The contribution of decreased fusion and reduced mitofusin-2 (MFN2) expression to PAH is unknown. OBJECTIVES: We hypothesize that decreased MFN2 expression promotes mitochondrial fragmentation, increases proliferation, and impairs apoptosis. The role of MFN2's transcriptional coactivator, peroxisome proliferator-activated receptor γ coactivator 1-α (PGC1α), was assessed. MFN2 therapy was tested in PAH PASMC and in models of PAH. METHODS: Fusion and fission mediators were measured in lungs and PASMC from patients with PAH and female rats with monocrotaline or chronic hypoxia+Sugen-5416 (CH+SU) PAH. The effects of adenoviral mitofusin-2 (Ad-MFN2) overexpression were measured in vitro and in vivo. MEASUREMENTS AND MAIN RESULTS: In normal PASMC, siMFN2 reduced expression of MFN2 and PGC1α; conversely, siPGC1α reduced PGC1α and MFN2 expression. Both interventions caused mitochondrial fragmentation. siMFN2 increased proliferation. In rodent and human PAH PASMC, MFN2 and PGC1α were decreased and mitochondria were fragmented. Ad-MFN2 increased fusion, reduced proliferation, and increased apoptosis in human PAH and CH+SU. In CH+SU, Ad-MFN2 improved walking distance (381 ± 35 vs. 245 ± 39 m; P < 0.05); decreased pulmonary vascular resistance (0.18 ± 0.02 vs. 0.38 ± 0.14 mm Hg/ml/min; P < 0.05); and decreased PA medial thickness (14.5 ± 0.8 vs. 19 ± 1.7%; P < 0.05). Lung vascularity was increased by MFN2. CONCLUSIONS: Decreased expression of MFN2 and PGC1α contribute to mitochondrial fragmentation and a proliferation-apoptosis imbalance in human and experimental PAH. Augmenting MFN2 has therapeutic benefit in human and experimental PAH.

Inhibition of mitochondrial fission prevents cell cycle progression in lung cancer.

Mitochondria exist in dynamic networks that undergo fusion and fission. Mitochondrial fusion and fission are mediated by several GTPases in the outer mitochondrial membrane, notably mitofusin-2 (Mfn-2), which promotes fusion, and dynamin-related protein (Drp-1), which promotes fission. We report that human lung cancer cell lines exhibit an imbalance of Drp-1/Mfn-2 expression, which promotes a state of mitochondrial fission. Lung tumor tissue samples from patients demonstrated a similar increase in Drp-1 and decrease in Mfn-2 when compared to adjacent healthy lung. Complementary approaches to restore mitochondrial network formation in lung cancer cells by overexpression of Mfn-2, Drp-1 inhibition, or Drp-1 knockdown resulted in a marked reduction of cancer cell proliferation and an increase in spontaneous apoptosis. The number of cancer cells in S phase decreased from 32.4 ± 0.6 to 6.4 ± 0.3% with Drp-1 inhibition (P<0.001). In a xenotransplantation model, Mfn-2 gene therapy or Drp-1 inhibition could regress tumor growth. The tumor volume decreased from 205.6 ± 59 to 70.6 ± 15 mm(3) (P<0.05) with Mfn-2 overexpression and from 186.0 ± 19 to 87.0 ± 6 mm(3) (P<0.01) with therapeutic Drp-1 inhibition. Impaired fusion and enhanced fission contribute fundamentally to the proliferation/apoptosis imbalance in cancer and constitute promising novel therapeutic targets.

A central role for CD68(+) macrophages in hepatopulmonary syndrome. Reversal by macrophage depletion.

RATIONALE: The etiology of hepatopulmonary syndrome (HPS), a common complication of cirrhosis, is unknown. Inflammation and macrophage accumulation occur in HPS; however, their importance is unclear. Common bile duct ligation (CBDL) creates an accepted model of HPS, allowing us to investigate the cause of HPS. OBJECTIVES: We hypothesized that macrophages are central to HPS and investigated the therapeutic potential of macrophage depletion. METHODS: Hemodynamics, alveolar-arterial gradient, vascular reactivity, and histology were assessed in CBDL versus sham rats (n = 21 per group). The effects of plasma on smooth muscle cell proliferation and endothelial tube formation were measured. Macrophage depletion was used to prevent (gadolinium) or regress (clodronate) HPS. CD68(+) macrophages and capillary density were measured in the lungs of patients with cirrhosis versus control patients (n = 10 per group). MEASUREMENTS AND MAIN RESULTS: CBDL increased cardiac output and alveolar-arterial gradient by causing capillary dilatation and arteriovenous malformations. Activated CD68(+)macrophages (nuclear factor-κB+) accumulated in HPS pulmonary arteries, drawn by elevated levels of plasma endotoxin and lung monocyte chemoattractant protein-1. These macrophages expressed inducible nitric oxide synthase, vascular endothelial growth factor, and platelet-derived growth factor. HPS plasma increased endothelial tube formation and pulmonary artery smooth muscle cell proliferation. Macrophage depletion prevented and reversed the histological and hemodynamic features of HPS. CBDL lungs demonstrated increased medial thickness and obstruction of small pulmonary arteries. Nitric oxide synthase inhibition unmasked exaggerated pulmonary vasoconstrictor responses in HPS. Patients with cirrhosis had increased pulmonary intravascular macrophage accumulation and capillary density. CONCLUSIONS: HPS results from intravascular accumulation of CD68(+)macrophages. An occult proliferative vasculopathy may explain the occasional transition to portopulmonary hypertension. Macrophage depletion may have therapeutic potential in HPS.

Epigenetic attenuation of mitochondrial superoxide dismutase 2 in pulmonary arterial hypertension: a basis for excessive cell proliferation and a new therapeutic target.

BACKGROUND: Excessive proliferation and impaired apoptosis of pulmonary artery (PA) smooth muscle cells (PASMCs) contribute to vascular obstruction in patients and fawn-hooded rats (FHRs) with PA hypertension (PAH). Expression and activity of mitochondrial superoxide dismutase-2 (SOD2), the major generator of H(2)O(2), is known to be reduced in PAH; however, the mechanism and therapeutic relevance of this are unknown. METHODS AND RESULTS: SOD2 expression in PASMCs is decreased in PAH patients and FHRs with PAH. FHR PASMCs have higher proliferation and lower apoptosis rates than Sprague-Dawley rat PASMCs. Moreover, FHR PASMCs have hyperpolarized mitochondria, low H(2)O(2) production, and reduced cytoplasmic and mitochondrial redox state. Administration of SOD2 small interfering RNA to normal PASMCs recapitulates the FHR PAH phenotype, hyperpolarizing mitochondria, decreasing H(2)O(2), and inhibiting caspase activity. Conversely, SOD2 overexpression in FHR PASMCs or therapy with the SOD-mimetic metalloporphyrin Mn(III)tetrakis (4-benzoic acid) porphyrin (MnTBAP) reverses the hyperproliferative PAH phenotype. Importantly, SOD-mimetic therapy regresses PAH in vivo. Investigation of the SOD2 gene revealed no mutation, suggesting a possible epigenetic dysregulation. Genomic bisulfite sequencing demonstrates selective hypermethylation of a CpG island in an enhancer region of intron 2 and another in the promoter. Differential methylation occurs selectively in PAs versus aortic SMCs and is reversed by the DNA methyltransferase inhibitor 5-aza-2'-deoxycytidine, restoring both SOD2 expression and the ratio of proliferation to apoptosis. Expression of the enzymes that mediate gene methylation, DNA methyltransferases 1 and 3B, is upregulated in FHR lungs. CONCLUSIONS: Tissue-specific, epigenetic SOD2 deficiency initiates and sustains a heritable form of PAH by impairing redox signaling and creating a proliferative, apoptosis-resistant PASMC. SOD augmentation regresses experimental PAH. The discovery of an epigenetic component to PAH may offer new therapeutic targets.

Manganese superoxide dismutase suppresses hypoxic induction of hypoxia-inducible factor-1alpha and vascular endothelial growth factor.

Hypoxia-inducible factor-1 (HIF-1) is a transcription factor that governs cellular responses to reduced O2 availability by mediating crucial homeostatic processes. HIF-1 is composed of an HIF-1alpha subunit and an HIF-1beta subunit. HIF-1alpha is degraded following enzyme-dependent hydroxylation of prolines of HIF-1alpha in the presence of molecular oxygen, Fe2+, alpha-ketoglutarate, and ascorbate. These cofactors contribute to the redox environment of cells. The antioxidant enzyme manganese superoxide dismutase (MnSOD) also modulates the cellular redox environment. Here we show that MnSOD suppressed hypoxic accumulation of HIF-1alpha protein in human breast carcinoma MCF-7 cells. This suppression was biphasic depending on MnSOD activity. At low levels of MnSOD activity, HIF-1alpha protein accumulated under hypoxic conditions. At moderate levels of MnSOD activity (two- to six-fold increase compared to parent cells), these accumulations were blocked. However, at higher levels of MnSOD activity (>6-fold increase), accumulation of HIF-1alpha protein was again observed. This biphasic modulation was observed under both 1 and 4% O2. Coexpression of mitochondrial hydrogen peroxide-removing proteins prevented the accumulation of HIF-1alpha protein in cells with high levels of MnSOD; this effect demonstrates that the restabilization of HIF-1alpha observed in high MnSOD overexpressors is probably due to hydrogen peroxide, most likely produced from MnSOD. Hypoxic induction of vascular endothelial growth factor (VEGF) protein was also suppressed by elevated MnSOD activity and its levels reflected HIF-1alpha protein levels. These observations demonstrated that HIF-1alpha accumulation and VEGF expression could be modulated by the antioxidant enzyme MnSOD.

Manganese superoxide dismutase overexpression inhibits the growth of androgen-independent prostate cancer cells.

This study investigates the role of the antioxidant enzyme manganese superoxide dismutase (MnSOD) in androgen-independent human prostate cancer (PC-3) cells' growth rate in vitro and in vivo. MnSOD levels were found to be lower in parental PC-3 cells compared to nonmalignant, immortalized human prostate epithelial cells (P69SV40T). To unravel the role of MnSOD in the prostate cancer phenotype, PC-3 cells were stably transfected with MnSOD cDNA plasmid. The MnSOD protein and activity levels in clones overexpressing MnSOD were increased seven- to eightfold. These cell lines showed elongated cell doubling time, reduced anchorage-independent growth in soft agar compared to parental PC-3 (Wt) cells, and reduced growth rate of PC-3 tumor xenografts in athymic nude mice. Flow cytometric studies showed an increase in membrane potential in the MnSOD-overexpressing clone (Mn32) compared to Wt and Neo cells. Also, production of extracellular H(2)O(2) was increased in the MnSOD-overexpressing clones. As determined by DNA cell cycle analysis, the proportion of cells in G(1) phase was enhanced by MnSOD overexpression. Therefore, MnSOD not only regulates cell survival but also affects PC-3 cell proliferation by retarding G(1) to S transition. Our results are consistent with MnSOD being a tumor suppressor gene in human prostate cancer.

Redox modulation of the liver with chronic antioxidant enzyme mimetic treatment prevents age-related oxidative damage associated with environmental stress.

A reduction in stress tolerance is a hallmark of the aging process, and the lowered functional capacity observed in aged organisms is associated with an increased rate of oxidative stress and a greater susceptibility of aged tissues to oxidative injury. In this report, we show that chronic systemic administration of a superoxide dismutase (SOD)/catalase mimetic (EUK-189), delivered over a 1 month period via osmotic pump, prevents heat stress-induced liver injury by dramatically decreasing oxidative damage in aged animals. Widespread liver injury was present in old but not young vehicle-treated rats in response to a 2 day heating protocol. However, SOD/catalase mimetic treatment markedly decreased the hyperthermia-induced liver injury associated in old animals. The reversal of damage with EUK-189 was associated with an improvement in intracellular redox status and a striking reduction in hepatocellular lipid peroxidation. EUK-189 treatment also blocked the activation of activator protein-1 (AP-1), which is a redox-sensitive early response transcription factor involved in the regulation of cellular stress responses. These results demonstrate that oxidative stress plays a unique role in age-related hyperthermic injury and suggest that therapeutic strategies aimed at improving redox potential, such as chronic SOD/catalase mimetic treatment, can prevent the oxidative-mediated damage associated with environmental stress.

MnSOD up-regulates maspin tumor suppressor gene expression in human breast and prostate cancer cells.

Manganese superoxide dismutase (MnSOD) is an antioxidant enzyme with tumor suppressor activity; however, the molecular mechanisms of MnSOD antitumor effects remain unclear. We hypothesized that MnSOD activity in cancer cells might cause downstream changes in the expression of other tumor suppressor genes. To determine whether maspin, a tumor suppressor gene that inhibits breast cancer cell invasion and metastasis, might be a target of MnSOD, we forced MnSOD expression in several human breast and prostate cancer cell lines by adenovirus-mediated gene transfer and measured maspin mRNA expression. Forced expression of MnSOD caused maspin mRNA to accumulate in a dose-dependent manner in both human breast and prostate cancer cells. Normal p53 was not necessary to mediate the effect of MnSOD because MnSOD up-regulated maspin in cells that harbor wild-type p53 and in cells that harbor mutant p53. Moreover, the effects of MnSOD on maspin were not due to demethylation of the maspin promoter. Analyses of maspin promoter activity, transcriptional run-on, and mRNA stability showed that maspin mRNA stability was the major mechanism for maspin up-regulation by MnSOD. Our findings identify a mechanism underlying MnSOD antitumor effects and provide evidence to support MnSOD as a genetic therapy in the treatment of human breast and prostate cancers.

L-PhGPx expression can be suppressed by antisense oligodeoxynucleotides.

Phospholipid hydroperoxide glutathione peroxidase (PhGPx) directly reduces hydroperoxides of phospholipid and cholesterol to their corresponding alcohols. There are two forms of PhGPx: L-PhGPx localizes in mitochondria and S-PhGPx in cytosol. Antisense oligodeoxynucleotides can inhibit specific protein expression. We tested the hypothesis that antisense oligodeoxynucleotides could be designed to inhibit PhGPx expression and thereby sensitize cells to lipid peroxidation induced by singlet oxygen. We chose P4 cells, a cell line established from L-PhGPx cDNA transfected MCF-7 cells, as our cell model. Lipid peroxidation was induced by singlet oxygen generated by Photofrin and visible light. We found that the antisense oligodeoxynucleotide (5' GCCGAGGCTCATCGCGGCGG 3') was effective in suppressing L-PhGPx mRNA, PhGPx protein, and activity. This antisense oligodeoxynucleotide did not interfere with S-PhGPx. When cells were exposed to singlet oxygen, lipid hydroperoxides were produced in the cells. L-PhGPx was able to remove these hydroperoxides; this removal was inhibited by antisense treatment. The inhibition of L-PhGPx by the antisense oligodeoxynucleotides also resulted in increased membrane damage as measured by trypan blue dye exclusion. These data demonstrate that PhGPx expression can be manipulated by antisense techniques.

Activation of matrix metalloproteinase-2 by overexpression of manganese superoxide dismutase in human breast cancer MCF-7 cells involves reactive oxygen species.

Matrix metalloproteinases (MMPs) participate in cell migration and remodeling processes by affecting the extracellular matrix. MMP-2 is thought to be involved in cancer cell invasiveness. It has been proposed that the activity of MMP-2 can be modulated by intracellular reactive oxygen species (ROS)/reactive nitrogen species. We hypothesized that manganese superoxide dismutase (MnSOD) could mediate MMP-2 activity by changing the intracellular ROS level and that nitric oxide ((.)NO) may be involved in this process. Human breast cancer MCF-7 cells were stably transfected with plasmids containing MnSOD cDNA. A 2-30-fold increase of MnSOD protein and activity was observed in four clones. Our data demonstrated that overexpression of MnSOD stimulated the activation of MMP-2 with a corresponding elevation of ROS. A decrease in ROS by ebselen, a glutathione peroxidase mimetic, or by transduction of adenovirus containing human catalase or glutathione peroxidase cDNA abolished the effect of MnSOD on MMP-2 activation. Treatment of MCF-7 cells with antimycin A or rotenone increased intracellular ROS production and MMP-2 activation simultaneously. Our data also showed a suppression of endothelial nitric-oxide synthase expression that was accompanied by decreased (.)NO production in MnSOD-overexpressing cells. However, the changes in endothelial nitric-oxide synthase and (.)NO did not correlate with the MnSOD activity. Corresponding changes of MMP-2 activity after the addition of a NOS inhibitor (N(G)-amino-l-arginine) or a (.)NO donor ((Z)-1-[(2-aminoethyl)-N-(2-ammonioethyl)amino]diazen-1-ium-1,2-diolate) to the cells suggested the possibility that (.)NO may be involved in the MnSOD-mediated MMP-2 activation pathway. These results indicate that MnSOD induces MMP-2 activity by regulation of intracellular ROS and imply that signaling pathways involving (.)NO may also be involved in the MnSOD mediation of MMP-2 activity.

Overexpression of copper zinc superoxide dismutase suppresses human glioma cell growth.

Copper zinc superoxide dismutase (CuZnSOD) is an essential primary antioxidant enzyme that converts superoxide radical to hydrogen peroxide and molecular oxygen in the cytoplasm. Cytosolic glutathione peroxidase (GPx) converts hydrogen peroxide into water. The overall goal of the present study was to explore the possible role of the antioxidant enzyme CuZnSOD in expression of the malignant phenotype. We hypothesized that overexpression of CuZnSOD would lead to the suppression of at least part of the human malignant phenotype. To test this hypothesis, human CuZnSOD cDNA was transfected into U118-9 human malignant glioma cells. CuZnSOD activity levels increased 1.5-, 2.0-, 2.6-, and 3.5-fold, respectively, in four table transfected cell lines compared with wild type and vector controls. Overexpression of CuZnSOD altered cellular antioxidant enzyme profiles, including those of manganese superoxide dismutase, catalase, and GPx. The transfected clone with the highest CuZnSOD:GPx ratio (3.5) showed a 42% inhibition of tumor cell growth in vitro. The decreased rate of tumor cell growth in vitro was strongly correlated with the enzyme activity ratio of CuZnSOD:GPx. Glioma cells that stably overexpressed CuZnSOD demonstrated additional suppressive effects on the malignant phenotype when compared with the parental cells and vector controls. These cells showed decreased plating efficiency, elongated cell population doubling time, lower clonogenic fraction in soft agar, and, more significantly, inhibition of tumor formation in nude mice. This work suggested that CuZnSOD is a new tumor suppressor gene. Increased intracellular ROS levels were found in cells with high activity ratios of CuZnSOD:GPx. Change in the cellular redox status, especially change attributable to the accumulation of hydrogen peroxide or other hydroperoxides, is a possible reason to explain the suppression of tumor growth observed in CuZnSOD-overexpressing cells.